A scientific subdiscipline that involves using computer technology to collect, store, analyze and disseminate biological data and information ~ NIH
DNA Sequence
Gene interactions
Electronic Health Records
Thousands of Covid-19 cases not reported because Excel spreadsheet had reached memory limit…
“.fasta”
Two line files, with > indicating the label for the following sequence.
>First line is "header" information, second line is sequence
GCGAGGCAGCCAGCGAGGGAGAGAGCGAGCGGGCG
“.fastq”
Four line files, with @ indicating the label for the following sequence.
Forth line is quality scores for each DNA base.
@Four line file, head, sequence, +, quality
TCGCACTCAACGCCCTGCATATGACAAGACAGAATC
+
<>;##=><9=AAAAAAAAAA9#:<#<;<<<????#=
Search for information or studies on the different omics and add them to the padlet.
Graph of decreased sequencing cost since human genome
Click each link to preview
Whole Genome Sequencing in paediatric cancer - experience and feedback from two families
This slide:
## Quarto
- Markdown editor
- Presentations
- Reports
- Books
See more at Quarto